Kinh doanh - Marketing
Kinh tế quản lý
Biểu mẫu - Văn bản
Tài chính - Ngân hàng
Công nghệ thông tin
Tiếng anh ngoại ngữ
Kĩ thuật công nghệ
Khoa học tự nhiên
Khoa học xã hội
Văn hóa nghệ thuật
Sức khỏe - Y tế
Văn bản luật
Nông Lâm Ngư
Kỹ năng mềm
Luận văn - Báo cáo
Giải trí - Thư giãn
Tài liệu phổ thông
Văn mẫu
Giới thiệu
Đăng ký
Đăng nhập
Tìm
Danh mục
Kinh doanh - Marketing
Kinh tế quản lý
Biểu mẫu - Văn bản
Tài chính - Ngân hàng
Công nghệ thông tin
Tiếng anh ngoại ngữ
Kĩ thuật công nghệ
Khoa học tự nhiên
Khoa học xã hội
Văn hóa nghệ thuật
Y tế sức khỏe
Văn bản luật
Nông lâm ngư
Kĩ năng mềm
Luận văn - Báo cáo
Giải trí - Thư giãn
Tài liệu phổ thông
Văn mẫu
Thông tin
Điều khoản sử dụng
Quy định bảo mật
Quy chế hoạt động
Chính sách bản quyền
Giới thiệu
Đăng ký
Đăng nhập
0
Trang chủ
Y Tế - Sức Khoẻ
Y học thường thức
DNA Methylation: Basic Mechanisms
Đang chuẩn bị liên kết để tải về tài liệu:
DNA Methylation: Basic Mechanisms
Tâm Đan
60
327
pdf
Đang chuẩn bị nút TẢI XUỐNG, xin hãy chờ
Tải xuống
We present two volumes of the Current Topics in Microbiology and Immunology devoted to work on DNA methylation. Although the 25 contributions appearing herein are by no means the proceedings of the Weissenburg Symposium on DNA Methylation held in May 2004, many of the authors of the current volumes and of the speakers at the symposium are the same; additional authors were invited later. The authors have been asked not to write a summary of their talks at the symposium but rather to outline their latest and most exciting discoveries and thoughts on the topic. The editors gratefully acknowledge the contributors’ esprit de corps of enthusiasm and punctuality with. | w. Doerfler p. Bohm Eds. DNA Methylation Basic Mechanisms 09ữCTCCCCẲrữẲÂJLẮẤCữẨGTJLữTẤẤJiTữTĨTTữĩẲẲẤẮẤíĩẤÁẤÀTữẤẮTẤẲẦẦTTẤTTẤTữC fẲẤTJLữTữT done m GGTrGGGATGAAAAAjTGAGTAGTAAATGTTTTGTAAAAAGAAAATG AATAAAATTATTATGGGAATAGTGT done GGTTGGG ATGAAAAATG AGTAGTAAATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGG AATAGTGT done M GGTTGGGATGAAAAliTGAGTAGTAAATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGG AATAƠTGT done M GGTTGGG ATG AAAAATGAGTAGTAAATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGGAATAGTGT done M GGTTGGG ATG AAAAATG AGTAGTAÀATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGG AATAGTGT done M GGrrGGG ATGAAAAJrTGAGTAGTAAATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGGAATAGTGT done f7 GGTTGGG ATGAAAA1 TG AGTAGTAAATOTĨTTGT AAAAAG AAAATG AATAAAATTATT ATGGG AATAGTGT â Springer 301 Current Topics in Microbiology and Immunology Editors R.W. Compans Atlanta Georgia M.D. Cooper Birmingham Alabama T. Honjo Kyoto H. Koprowski Philadelphia Pennsylvania F. Melchers Basel - M.B.A. Oidstone Lajolla California s. Olsnes Osla M.Potter Betíiesda Maoyland P.K. Vogt In SeUa CaSOSornia H. Wagner Munich w. Doerfler and p. Bohm Eds. DNA Methylation Basic Mechanisms With 24 Figures and 3 Tables .
TÀI LIỆU LIÊN QUAN
DNA Methylation: Basic Mechanisms - Part 1
DNA Methylation: Basic Mechanisms - Part 2
DNA Methylation: Basic Mechanisms - Part 3
DNA Methylation: Basic Mechanisms - Part 4
DNA Methylation: Basic Mechanisms - Part 5
DNA Methylation: Basic Mechanisms - Part 6
DNA Methylation: Basic Mechanisms - Part 7
DNA Methylation: Basic Mechanisms - Part 8
DNA Methylation: Basic Mechanisms - Part 9
DNA Methylation: Basic Mechanisms - Part 10
crossorigin="anonymous">
Đã phát hiện trình chặn quảng cáo AdBlock
Trang web này phụ thuộc vào doanh thu từ số lần hiển thị quảng cáo để tồn tại. Vui lòng tắt trình chặn quảng cáo của bạn hoặc tạm dừng tính năng chặn quảng cáo cho trang web này.