tailieunhanh - Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and theunrgene encoded polypeptide (UNR) to the adenine-rich autoregu-latory sequence (ARS) located at the 5¢ untranslated region of the PABP-mRNA. | ễFEBS Journal IMP1 interacts with poly A -binding protein PABP and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain Gopal P. Patel and Jnanankur Bag Department of Molecular and Cellular Biology University of Guelph Ontario Canada Keywords autoregulation IMP1 PABP poly A -binding protein translational control Correspondence J. Bag Department of Molecular and Cellular Biology University of Guelph Guelph Ontario N1G 2W1 Canada Fax 1 519 837 2075 Tel 1 519 824 4120 Ext. 53390 E-mail jbag@ Received 12 June 2006 revised 1 October 2006 accepted 25 October 2006 doi Repression of poly A -binding protein PABP mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP insulin-like growth factor II mRNA binding protein-1 IMP1 and the unr gene encoded polypeptide UNR to the adenine-rich autoregu-latory sequence ARS located at the 5 untranslated region of the PABP-mRNA. In this report we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be nM and nM respectively. Both PABP and IMP1 interact with each other regardless of the presence of the ARS through the conserved C-terminal PABP-C and K-homology KH III-IV domains respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3 end of the ARS. Results of our analysis suggest that both protein-protein and protein-RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA. Regulation of gene expression is .