tailieunhanh - Cloning 101: A Primer

Once you have your restriction enzymes chosen, it is time to design the final complete gene The multiple cloning site (or whatever plasmid you are cloning into) should already have the 5’ portion of the gene intact (. RBS, spacer, Met) Sequences must be in frame | Ghosh Lab University of Arizona Department of Chemistry Cloning 101: A Primer Outline Cloning overview pDRAW32 Design Gene Insert Primers Further considerations (optimization of the process) Transformation Cloning Overview Four main steps in cloning: Insert synthesis Restriction enzyme digest Ligation Transformation + Functional construct Plasmid (vector) Insert (your gene) Design Overview Steps to follow in designing your cloning experiment: Design your gene Design your insert Pick your enzymes Check your design Recheck your design Functional construct All of the important information in one place! pDRAW32 Plasmid maps: pDRAW32 pDRAW32 You can look at the sequence in detail Open reading frames Translation Restriction sites Complementary strand Design of the Gene Example, the gene we want: G C D R A S P Y C G We got this from phage display: ggctgcgacagggcgagcccgtactgcggt G C D R A S P Y C G Phage sequence Final sequence for the gene of interest: ggctgcgacagggcgagcccgtactgcggttaa G C D | Ghosh Lab University of Arizona Department of Chemistry Cloning 101: A Primer Outline Cloning overview pDRAW32 Design Gene Insert Primers Further considerations (optimization of the process) Transformation Cloning Overview Four main steps in cloning: Insert synthesis Restriction enzyme digest Ligation Transformation + Functional construct Plasmid (vector) Insert (your gene) Design Overview Steps to follow in designing your cloning experiment: Design your gene Design your insert Pick your enzymes Check your design Recheck your design Functional construct All of the important information in one place! pDRAW32 Plasmid maps: pDRAW32 pDRAW32 You can look at the sequence in detail Open reading frames Translation Restriction sites Complementary strand Design of the Gene Example, the gene we want: G C D R A S P Y C G We got this from phage display: ggctgcgacagggcgagcccgtactgcggt G C D R A S P Y C G Phage sequence Final sequence for the gene of interest: ggctgcgacagggcgagcccgtactgcggttaa G C D R A S P Y C G * Add a stop codon If you are cloning out of a known plasmid, just use the sequence that you have Design of the Gene If you are designing the gene from scratch, keep in mind codon usage Not all codons are created equal Un-optimized codons could lead to lower expression levels The codon usage reflects levels of tRNA available in E. Coli Pay attention to the stop codons too (XL1-Blues read through TAG {amber stop codon} 20% of the time) or preferably What if we don’t have the DNA sequence? Design from scratch! (don’t forget about codon usage) Endonucleases (or restriction enzymes) are enzymes which cut DNA at specific internal recognition sequences Compare to exonucleases, which cut from one end You must choose restriction sites that are available in the plasmid you are cloning into They must not appear in your gene (silent mutation can remove unwanted .