tailieunhanh - DNA Methylation: Basic Mechanisms

We present two volumes of the Current Topics in Microbiology and Immunology devoted to work on DNA methylation. Although the 25 contributions appearing herein are by no means the proceedings of the Weissenburg Symposium on DNA Methylation held in May 2004, many of the authors of the current volumes and of the speakers at the symposium are the same; additional authors were invited later. The authors have been asked not to write a summary of their talks at the symposium but rather to outline their latest and most exciting discoveries and thoughts on the topic. The editors gratefully acknowledge the contributors’ esprit de corps of enthusiasm and punctuality with. | w. Doerfler p. Bohm Eds. DNA Methylation Basic Mechanisms 09ữCTCCCCẲrữẲÂJLẮẤCữẨGTJLữTẤẤJiTữTĨTTữĩẲẲẤẮẤíĩẤÁẤÀTữẤẮTẤẲẦẦTTẤTTẤTữC fẲẤTJLữTữT done m GGTrGGGATGAAAAAjTGAGTAGTAAATGTTTTGTAAAAAGAAAATG AATAAAATTATTATGGGAATAGTGT done GGTTGGG ATGAAAAATG AGTAGTAAATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGG AATAGTGT done M GGTTGGGATGAAAAliTGAGTAGTAAATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGG AATAƠTGT done M GGTTGGG ATG AAAAATGAGTAGTAAATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGGAATAGTGT done M GGTTGGG ATG AAAAATG AGTAGTAÀATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGG AATAGTGT done M GGrrGGG ATGAAAAJrTGAGTAGTAAATGTTTTGTAAAAAGAAAATGAATAAAATTATTATGGGAATAGTGT done f7 GGTTGGG ATGAAAA1 TG AGTAGTAAATOTĨTTGT AAAAAG AAAATG AATAAAATTATT ATGGG AATAGTGT â Springer 301 Current Topics in Microbiology and Immunology Editors . Compans Atlanta Georgia . Cooper Birmingham Alabama T. Honjo Kyoto H. Koprowski Philadelphia Pennsylvania F. Melchers Basel - . Oidstone Lajolla California s. Olsnes Osla Betíiesda Maoyland . Vogt In SeUa CaSOSornia H. Wagner Munich w. Doerfler and p. Bohm Eds. DNA Methylation Basic Mechanisms With 24 Figures and 3 Tables .

• Y học thường thức
• medical books
• pharmacology
• epidemiologic
• Obstetrics
• anatomy
• Preventing Morbidity
• Multidisciplinary Care
• Biomedical Electronics
• Medical Equipment
• Medical Imaging
• Electronic Medical Records
• Image Data Compression
• radiation physics
• Modern Physics
• medical physiscists
• Interaction Mechanisms
• Medical Applications
• Laser Safety
• Biological Considerations
• Intraocular
• Retinal Prosthesis
• Probability Theory
• Random Processes
• Engineering Statistics
• Microfluidic Devices
• Microfabricated Devices
• Cell Manipulation
• Bioinstrumentation
• Circuit Theory
• Introductory Biomedical Engineering
• Sacrificial Oxide Layer
• Drug Delivery
• Nanofabrication
• developmental systems
• Cleavage
• lumen formation
• blastula formation
• Electricity Inside Us
• Heart Pulse
• Crocodile Tears
• Mechanics
• Molecular Transport
• Regulation
• Microcirculation
• Gene Expression
• Extracellular Matrix
• physiology
• Capstone Design Experience
• Meet Student Needs
• Changing Needs
• Integrated Wholes
• General System Theory
• Systems Biology
• Empirical Force Fields
• Computational Methods
• Domain Partitioning
• Basic Principles
• Tissue Engineering
• Cell Culture
• biological basis
• The cytoskeleton
• cell mechanics
• Larger Organisms
• Cell Populations
• Individual Cells
• Emergent Computation
• Automata Theory
• Bioinformatics
• Biomedical research
• Clinical research
• Human stem cells
• Functional Genomics
• Interpreting Microarray
• Proteomics