tailieunhanh - SEQUENCE ALIGNMENT

In bioinformatics, a sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity that may be a consequence of functional, structural, or evolutionary relationships between the sequences.[1] Aligned sequences of nucleotide or amino acid residues are typically represented as rows within a matrix. Gaps are inserted between the residues so that identical or similar characters are aligned in successive columns. | SEQUENCE ALIGNMENT Two Alignment Multiple Alignment Fundamental steps of the procedure leading to optimal 2 sequences alignment C L E C L E GTTAATTGCAGCCTGTATGCCAGCGGCATCGGCAAGGAIGGGACGAGTTGGGTAGCC 1 VNCSLYASG I GKDGT SWVA 2 ATTGATTGCTCTCCGTACCTCCAA I D C S P Y L Q GTTGTAAGAGATGGTAACACCATGGTAGCC V V R D G N T M V A Comparison of the fragments of 1st and 2nd domain of chicken ovomucoid using unitary matrix GCM PAM25o and algorithm of genetic semihomology UNITARY MATRIX V I 0 N D 0 C C 1 S S 1 L P 0 Y Y 1 A S G I G K D G LQ V V R D G 0 0 0 0 0 0 1 1 T N 0 S T 0 W V M V 0 1 A A 1 SCORE 7 19 GENETIC CODE MATRIX GIIAATIGCAGCCTGIAIGCCAGCGGCATCGGCAAGGAIGGGACGAGTIGGGTAGCC AIIGATIGCTCTCCGIACCIC CAA GTTGTAAGAGAIGGTAACACCAIGGTAGCC 2 2 3 0 2 2 1 0 0 1113 2 PAM250 SCORING 1 1 1 3 3 29 57 V I 1 N D 1 C C 2 S S 2 L P 0 Y Y 2 A L 0 SGI G K D G Q V V R D G 0 0 10 12 2 T N 1 S T 1 W V M V 0 2 A A 2 42 97 42 89 20 38 GENETIC SEMIHOMOLOGY V I 2 N D 2 C C 3 S S 3 L P 2 Y Y 3 ASGI GKDGTS L Q V V R D G N T 0 0 0 2 1 2 3 3 1 1 WV MV 03 A A 3 34 57 .