tailieunhanh - Freeland - Molecular Ecology (Wiley, 2005) - Answer

Answers to Review Questions Chapter 1 Nucleotide insertion. This is a frameshift mutation. Following this mutation, all but the first triplet encode different amino acids. The functionality is changed and therefore mutation is unlikely to be neutral. | Answers to Review Questions Chapter 1 . i Nucleotide insertion. This is a frameshift mutation. Following this mutation all but the first triplet encode different amino acids. The functionality is changed and therefore mutation is unlikely to be neutral. ii Nucleotide substitution in which a C was replaced with an A transversion . The original CCC and derived CCA codons both specify proline. This is therefore a synonymous substitution and is probably neutral. . There are 13 transitions and 13 transversions therefore the ratio is . . The primer pair is shown in bold below in the positions that the primers would anneal to the sequences during PCR 5 - CTCACTTTCCTCCACGAAACAGGCTCAAACAACCCAACGGGCATCCCCTCAGATTGCGAC -3 3 - GGGAGTCTAACGCTG - 5 5 - CTCACTTTCCTCCAC 3 3 - GAGTGAAAGGAGGTGCTTTGTCCGAGTTTGTTGGGTTGCCCGTAGGGGAGTCTAACGCTG-5 . The sequence is TGTGGAAGACCTAAT. Molecular Ecology Joanna Freeland 2005 John Wiley Sons Ltd. 328 ANSWERS TO REVIEW QUESTIONS Chapter 2 . Advantages include High mutation rates therefore relatively likely to detect variation. Conserved arrangement of sequences therefore many universal primers are available. No recombination and uniparental inheritance make it relatively easy to retrace genetic lineages. Small effective population size compared with most nuclear genes therefore sensitive to demographic processes. Maternally inherited therefore can be useful when studying hybridization. Disadvantages include Small effective population size compared with most nuclear genes therefore may exaggerate the effects of past events and lead to underestimation of genetic diversity. Acts as a single locus and therefore there is no scope for comparing the genealogies of multiple genes. Maternally inherited and therefore can give an incomplete picture . if only males disperse. Mitochondrial pseudogenes are common in some species. . i Both chloroplasts and mitochondria are maternally inherited in angio- sperms therefore this comparison .